Genome Browser


<font color='red'>SUN JRE 1.4 or higher is required.</font>

SNP Information

dbSNP ID  rs28938172
JSNP ID  -
Chromosome  12
Chromosome Position  48275668
Strand  +
Allele  C/T
Validation Class  SNP: single nucleotide polymorphism
SNP Effect  POLYPHEN  SIFT

Gene Information

Type mRNA Accession Gene Strand mRNA_Pos Codon_Pos Protein_Pos Allele Codons AminoAcid
 Intron  NM_032130  C12orf25  -  -  -  -  C/T    -

Disease Information

Disease Hit  1
Disease Name  Parkinson Disease
Others  -

Disease Information

dbSNP JSNP ALFRED
  -   -   -

Flanking Sequence

dbSNP
>gnl|dbSNP|rs28938172 rs=28938172|pos=251|len=501|taxid=9606|mol=cDNA|class=1|alleles=C/T|build=125
TCTGAGTCTGCTGCTGTGAAGGAGATACTGAAGGAGCAGGAAAACCGGAA
GGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATG
AAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAA
ATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGA
CGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGC
Y
TGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGG
CTCCACTTGTTCTTAAAGACTAGAGCAGCGAACTGCGACGATCACTTAGA
GAAACAGGCCGTTAGGAATCCATTCTCACTGTGTTCGCTCTAAACAAAAC
AGTGGTAGGTTAATGTGTTCAGAAGTCGCTGTCCTTACTACTTTTGCGGA
AGTATGGAAGTCACAACTACACAGAGATTTCTCAGCCTACAAATTGTGTC 
JSNP
>gnl|dbSNP|rs28938172 rs=28938172|pos=251|len=501|taxid=9606|mol=cDNA|class=1|alleles=C/T|build=125
TCTGAGTCTGCTGCTGTGAAGGAGATACTGAAGGAGCAGGAAAACCGGAA
GGGCCTGATAGCCGCCATCTGTGCAGGTCCTACTGCTCTGTTGGCTCATG
AAATAGGTTTTGGAAGTAAAGTTACAACACACCCTCTTGCTAAAGACAAA
ATGATGAATGGAGGTCATTACACCTACTCTGAGAATCGTGTGGAAAAAGA
CGGCCTGATTCTTACAAGCCGGGGGCCTGGGACCAGCTTCGAGTTTGCGC
Y
TGCAATTGTTGAAGCCCTGAATGGCAAGGAGGTGGCGGCTCAAGTGAAGG
CTCCACTTGTTCTTAAAGACTAGAGCAGCGAACTGCGACGATCACTTAGA
GAAACAGGCCGTTAGGAATCCATTCTCACTGTGTTCGCTCTAAACAAAAC
AGTGGTAGGTTAATGTGTTCAGAAGTCGCTGTCCTTACTACTTTTGCGGA
AGTATGGAAGTCACAACTACACAGAGATTTCTCAGCCTACAAATTGTGTC