Genome Browser


<font color='red'>SUN JRE 1.4 or higher is required.</font>

SNP Information

dbSNP ID  rs28934874
JSNP ID  -
Chromosome  17
Chromosome Position  7519204
Strand  -
Allele  A/C/T
Validation Class  SNP: single nucleotide polymorphism
SNP Effect  POLYPHEN  SIFT

Gene Information

Type mRNA Accession Gene Strand mRNA_Pos Codon_Pos Protein_Pos Allele Codons AminoAcid
 CDS  NM_000546  TP53  -  775  2  175  A/C/T    -

Disease Information

Disease Hit  1
Disease Name  UGATZ TUMORE GAIZTOA
Others  -

Disease Information

dbSNP JSNP ALFRED
  -   -   -

Flanking Sequence

dbSNP
>gnl|dbSNP|rs28934874 rs=28934874|pos=251|len=501|taxid=9606|mol=cDNA|class=1|alleles=A/C/T|build=125
AGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGG
CCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAG
AAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGG
GACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGT
TTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACA
H
CCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAG
CACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGA
TAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATT
TGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTG
GTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTA 
JSNP
>gnl|dbSNP|rs28934874 rs=28934874|pos=251|len=501|taxid=9606|mol=cDNA|class=1|alleles=A/C/T|build=125
AGAGGCTGCTCCCCGCGTGGCCCCTGCACCAGCAGCTCCTACACCGGCGG
CCCCTGCACCAGCCCCCTCCTGGCCCCTGTCATCTTCTGTCCCTTCCCAG
AAAACCTACCAGGGCAGCTACGGTTTCCGTCTGGGCTTCTTGCATTCTGG
GACAGCCAAGTCTGTGACTTGCACGTACTCCCCTGCCCTCAACAAGATGT
TTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACA
H
CCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAG
CACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGA
TAGCGATGGTCTGGCCCCTCCTCAGCATCTTATCCGAGTGGAAGGAAATT
TGCGTGTGGAGTATTTGGATGACAGAAACACTTTTCGACATAGTGTGGTG
GTGCCCTATGAGCCGCCTGAGGTTGGCTCTGACTGTACCACCATCCACTA