Genome Browser


<font color='red'>SUN JRE 1.4 or higher is required.</font>

SNP Information

dbSNP ID  rs28933984
JSNP ID  -
Chromosome  1
Chromosome Position  59238249
Strand  +
Allele  A/G
Validation Class  SNP: single nucleotide polymorphism
SNP Effect  POLYPHEN  SIFT

Gene Information

Type mRNA Accession Gene Strand mRNA_Pos Codon_Pos Protein_Pos Allele Codons AminoAcid

Disease Information

Disease Hit  0
Disease Name  -
Others  no cui diseases

Disease Information

dbSNP JSNP ALFRED
  -   -   -

Flanking Sequence

dbSNP
>gnl|dbSNP|rs28933984 rs=28933984|pos=251|len=501|taxid=9606|mol=cDNA|class=1|alleles=A/G|build=125
GTGGTGAACTCTGCCTTATATAATGTGGATGCTGGGCACAGAGCTGTCAT
CTTTGACCGATTCCGTGGAGTGCAGGACATTGTGGTAGGGGAAGGGACTC
ATTTTCTCATCCCGTGGGTACAGAAACCAATTATCTTTGACTGCCGTTCT
CGACCACGTAATGTGCCAGTCATCACTGGTAGCAAAGATTTACAGAATGT
CAACATCACACTGCGCATCCTCTTCCGGCCTGTCGCCAGCCAGCTTCCTC
R
CATCTTCACCAGCATCGGAGAGGACTATGATGAGCGTGTGCTGCCGTCCA
TCACAACTGAGATCCTCAAGTCAGTGGTGGCTCGCTTTGATGCTGGAGAA
CTAATCACCCAGAGAGAGCTGGTCTCCAGGCAGGTGAGCGACGACCTTAC
AGAGCGAGCCGCCACCTTTGGGCTCATCCTGGATGACGTGTCCTTGACAC
ATCTGACCTTCGGGAAGGAGTTCACAGAAGCGGTGGAAGCCAAACAGGTG 
JSNP
>gnl|dbSNP|rs28933984 rs=28933984|pos=251|len=501|taxid=9606|mol=cDNA|class=1|alleles=A/G|build=125
GTGGTGAACTCTGCCTTATATAATGTGGATGCTGGGCACAGAGCTGTCAT
CTTTGACCGATTCCGTGGAGTGCAGGACATTGTGGTAGGGGAAGGGACTC
ATTTTCTCATCCCGTGGGTACAGAAACCAATTATCTTTGACTGCCGTTCT
CGACCACGTAATGTGCCAGTCATCACTGGTAGCAAAGATTTACAGAATGT
CAACATCACACTGCGCATCCTCTTCCGGCCTGTCGCCAGCCAGCTTCCTC
R
CATCTTCACCAGCATCGGAGAGGACTATGATGAGCGTGTGCTGCCGTCCA
TCACAACTGAGATCCTCAAGTCAGTGGTGGCTCGCTTTGATGCTGGAGAA
CTAATCACCCAGAGAGAGCTGGTCTCCAGGCAGGTGAGCGACGACCTTAC
AGAGCGAGCCGCCACCTTTGGGCTCATCCTGGATGACGTGTCCTTGACAC
ATCTGACCTTCGGGAAGGAGTTCACAGAAGCGGTGGAAGCCAAACAGGTG