Genome Browser


<font color='red'>SUN JRE 1.4 or higher is required.</font>

SNP Information

dbSNP ID  rs28932770
JSNP ID  -
Chromosome  19
Chromosome Position  61523235
Strand  -
Allele  C/T
Validation Class  SNP: single nucleotide polymorphism
SNP Effect  POLYPHEN  SIFT

Gene Information

Type mRNA Accession Gene Strand mRNA_Pos Codon_Pos Protein_Pos Allele Codons AminoAcid

Disease Information

Disease Hit  1
Disease Name  DIABETES MELITUSA
Others  -

Disease Information

dbSNP JSNP ALFRED
  -   -   -

Flanking Sequence

dbSNP
>gnl|dbSNP|rs28932770 rs=28932770|pos=251|len=501|taxid=9606|mol=cDNA|class=1|alleles=C/T|build=125
ATTTCACGTCGTACTCGCCTGGCCTTTCTAAATGTCCAGGCAGCAGAGGA
AGCCCTACCCAGGATTGTTGAACTGATGGGCAGGGAACTGAATTGGGATG
ATTATAAGAAGCAGGAACAACTTGAAACAGCCAGGAAGTTTCTATATTAT
GAAATGGGCTATAAATCTCGATCAGAACAGTTAACAGATCGCTCTGAAAT
TAGCCTACTGCCTTCAGACATTGACAGGTATAAGAAGAGATTTCATAAGT
Y
TGATGCAGACCAGAAAGGCTTTATTACCATTGTTGATGTTCAGCGTGTAT
TAGAGAGTATCAATGTCCAAATGGATGAAAATACACTCCATGAAATTCTA
AATGAAGTTGATTTGAATAAAAATGGACAGGTTGAACTCAATGAATTTTT
GCAGCTGATGAGTGCTATTCAAAAAGGAAGGGTATCTGGAAGCCGGCTTG
CTATACTAATGAAAACTGCAGAAGAGAACCTCGACAGAAGAGTTCCAATT 
JSNP
>gnl|dbSNP|rs28932770 rs=28932770|pos=251|len=501|taxid=9606|mol=cDNA|class=1|alleles=C/T|build=125
ATTTCACGTCGTACTCGCCTGGCCTTTCTAAATGTCCAGGCAGCAGAGGA
AGCCCTACCCAGGATTGTTGAACTGATGGGCAGGGAACTGAATTGGGATG
ATTATAAGAAGCAGGAACAACTTGAAACAGCCAGGAAGTTTCTATATTAT
GAAATGGGCTATAAATCTCGATCAGAACAGTTAACAGATCGCTCTGAAAT
TAGCCTACTGCCTTCAGACATTGACAGGTATAAGAAGAGATTTCATAAGT
Y
TGATGCAGACCAGAAAGGCTTTATTACCATTGTTGATGTTCAGCGTGTAT
TAGAGAGTATCAATGTCCAAATGGATGAAAATACACTCCATGAAATTCTA
AATGAAGTTGATTTGAATAAAAATGGACAGGTTGAACTCAATGAATTTTT
GCAGCTGATGAGTGCTATTCAAAAAGGAAGGGTATCTGGAAGCCGGCTTG
CTATACTAATGAAAACTGCAGAAGAGAACCTCGACAGAAGAGTTCCAATT