Genome Browser


<font color='red'>SUN JRE 1.4 or higher is required.</font>

SNP Information

dbSNP ID  rs1800709
JSNP ID  -
Chromosome  17
Chromosome Position  38498553
Strand  -
Allele  C/T
Validation Class  SNP: single nucleotide polymorphism
SNP Effect  POLYPHEN  SIFT

Gene Information

Type mRNA Accession Gene Strand mRNA_Pos Codon_Pos Protein_Pos Allele Codons AminoAcid
 CDS-nonsynonymous  NM_007295  BRCA1  -  2918  1  841  C/T  CGG/TGG  R/W
 CDS-nonsynonymous  NM_007294  BRCA1  -  2721  1  841  C/T  CGG/TGG  R/W
 CDS-nonsynonymous  NM_007296  BRCA1  -  2715  1  841  C/T  CGG/TGG  R/W
 CDS-nonsynonymous  NM_007297  BRCA1  -  2032  1  545  C/T  CGG/TGG  R/W
 Intron  NM_007298  BRCA1  -  -  -  -  C/T    -
 CDS-nonsynonymous  NM_007299  BRCA1  -  2721  1  841  C/T  CGG/TGG  R/W
 CDS-nonsynonymous  NM_007300  BRCA1  -  2721  1  841  C/T  CGG/TGG  R/W
 CDS-nonsynonymous  NM_007302  BRCA1  -  2598  1  800  C/T  CGG/TGG  R/W
 Intron  NM_007303  BRCA1  -  -  -  -  C/T    -
 Intron  NM_007304  BRCA1  -  -  -  -  C/T    -
 Intron  NM_007305  BRCA1  -  -  -  -  C/T    -

Disease Information

Disease Hit  1
Disease Name  UGATZ TUMORE GAIZTOA
Others  -

Disease Information

dbSNP JSNP ALFRED
 
TC
0.0020.997
  
  -   -

Flanking Sequence

dbSNP
>gnl|dbSNP|rs1800709 rs=1800709|pos=301|len=601|taxid=9606|mol=genomic|class=1|alleles=C/T|build=113
TCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGT
TTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTG
GTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCACT
CTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGC
ATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAA
ATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGT
Y
GGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTG
CAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAA
TCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGT
CCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAA
GAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTTAA
TATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGATA 
JSNP
>gnl|dbSNP|rs1800709 rs=1800709|pos=301|len=601|taxid=9606|mol=genomic|class=1|alleles=C/T|build=113
TCTAATAATGCTGAAGACCCCAAAGATCTCATGTTAAGTGGAGAAAGGGT
TTTGCAAACTGAAAGATCTGTAGAGAGTAGCAGTATTTCATTGGTACCTG
GTACTGATTATGGCACTCAGGAAAGTATCTCGTTACTGGAAGTTAGCACT
CTAGGGAAGGCAAAAACAGAACCAAATAAATGTGTGAGTCAGTGTGCAGC
ATTTGAAAACCCCAAGGGACTAATTCATGGTTGTTCCAAAGATAATAGAA
ATGACACAGAAGGCTTTAAGTATCCATTGGGACATGAAGTTAACCACAGT
Y
GGGAAACAAGCATAGAAATGGAAGAAAGTGAACTTGATGCTCAGTATTTG
CAGAATACATTCAAGGTTTCAAAGCGCCAGTCATTTGCTCCGTTTTCAAA
TCCAGGAAATGCAGAAGAGGAATGTGCAACATTCTCTGCCCACTCTGGGT
CCTTAAAGAAACAAAGTCCAAAAGTCACTTTTGAATGTGAACAAAAGGAA
GAAAATCAAGGAAAGAATGAGTCTAATATCAAGCCTGTACAGACAGTTAA
TATCACTGCAGGCTTTCCTGTGGTTGGTCAGAAAGATAAGCCAGTTGATA