Genome Browser


<font color='red'>SUN JRE 1.4 or higher is required.</font>

SNP Information

dbSNP ID  rs144848
JSNP ID  -
Chromosome  13
Chromosome Position  31804729
Strand  -
Allele  G/T
Validation Class  SNP: single nucleotide polymorphism
SNP Effect  POLYPHEN  SIFT

Gene Information

Type mRNA Accession Gene Strand mRNA_Pos Codon_Pos Protein_Pos Allele Codons AminoAcid
 CDS-nonsynonymous  NM_000059  BRCA2  +  1341  1  372  G/T  CAT/AAT  H/N

Disease Information

Disease Hit  1
Disease Name  UGATZ TUMORE GAIZTOA
Others  -

Disease Information

dbSNP JSNP ALFRED
 
GTAC
0.2340.7080.0360.020
  -   -

Flanking Sequence

dbSNP
>gnl|dbSNP|rs144848 rs=144848|pos=301|len=601|taxid=9606|mol=genomic|class=1|alleles=G/T|build=126
GCTCTTCATCTCTCTTATTTACCACTGTTTCCTCATTTAATGGCTTCTCT
GATTTTGGTAGGCTAGAAATACGTGGCAAAGAATTCTCTGAAGTAAGAAA
ATCTTTCTTTCTTTTGTTCTCTGTGTCTAATAGGTCTTTTTCTGAAATAT
TTTGGTCACATGAAGAAATATGCAATAGGGGTATTTTCTCCATCTGGGCT
CCATTTAGACCTGAAAGGGTTAGTTGAGACCATTCACAGGCCAAAGACGG
TACAACTTCCTTGGAGATTTTGTCACTTCCACTCTCAAAGGGCTTCTGAT
K
TGCTACATTTGAATCTAATGGATCAGTATCATTTGGTTCCACTTCAGATA
CAAATGAGTATTTTTCTTTCACTTGGTTTTTAGATTTTTCACATTCATCA
GCGTTTGCTTCATGGAAAATTTTTTTCCTAGTCTTGCTAGTTCTTACTTT
TTGTAGATTTTTTGTTCTACATTTAGAAAAACATAATGAAAAACTATCTT
CTTCAGAGGTATCTACAACTGTTTCATATACTTCATCTTCTAGGACATTT
GGCATTGACTTTCCAATGTGGTCTTTGCAGCTATTTACTTTAAATGAATT 
JSNP
>gnl|dbSNP|rs144848 rs=144848|pos=301|len=601|taxid=9606|mol=genomic|class=1|alleles=G/T|build=126
GCTCTTCATCTCTCTTATTTACCACTGTTTCCTCATTTAATGGCTTCTCT
GATTTTGGTAGGCTAGAAATACGTGGCAAAGAATTCTCTGAAGTAAGAAA
ATCTTTCTTTCTTTTGTTCTCTGTGTCTAATAGGTCTTTTTCTGAAATAT
TTTGGTCACATGAAGAAATATGCAATAGGGGTATTTTCTCCATCTGGGCT
CCATTTAGACCTGAAAGGGTTAGTTGAGACCATTCACAGGCCAAAGACGG
TACAACTTCCTTGGAGATTTTGTCACTTCCACTCTCAAAGGGCTTCTGAT
K
TGCTACATTTGAATCTAATGGATCAGTATCATTTGGTTCCACTTCAGATA
CAAATGAGTATTTTTCTTTCACTTGGTTTTTAGATTTTTCACATTCATCA
GCGTTTGCTTCATGGAAAATTTTTTTCCTAGTCTTGCTAGTTCTTACTTT
TTGTAGATTTTTTGTTCTACATTTAGAAAAACATAATGAAAAACTATCTT
CTTCAGAGGTATCTACAACTGTTTCATATACTTCATCTTCTAGGACATTT
GGCATTGACTTTCCAATGTGGTCTTTGCAGCTATTTACTTTAAATGAATT